Quick Order

Text Size:AAA

Mouse MAP2K2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MAP2K2 cDNA Clone Product Information
Gene_bank_ref_id:BC014830.1
RefSeq ORF Size:1206bp
cDNA Description:Full length Clone DNA of Mus musculus mitogen-activated protein kinase kinase 2 with N terminal Myc tag.
Gene Synonym:MK2, MEK2, Prkmk2, AA589381
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

References
  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.
  • Size / Price
    Catalog: MG50338-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"