After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD33 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD33cDNA Clone Product Information
Gene_bank_ref_id:BC028152
cDNA Size:1095
cDNA Description:ORF Clone of Homo sapiens CD33 molecule DNA.
Gene Synonym:p67, SIGLEC3, SIGLEC-3
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3, is a member of the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. This Single-pass type I membrane protein contains 1 Ig-like C2-type (immunoglobulin-like) domain and 1 Ig-like V-type (immunoglobulin-like) domain. CD33 /Siglec-3 is a putative adhesion molecule of myelomonocytic-derived cells that mediates sialic-acid dependent binding to cells. CD33 /Siglec-3 preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. CD33/Siglec-3 induces apoptosis in acute myeloid leukemia (in vitro). CD33/Siglec-3 can function as a sialic acid-dependent cell adhesion molecule and that binding can be modulated by endogenous sialoglycoconjugates when CD33 is expressed in a plasma membrane.

References
  • Simmons D, et al. (1988) Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. J Immunol. 141(8): 2797-800.
  • Ulyanova T, et al. (1999) The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. Eur J Immunol. 29(11): 3440-9.
  • Freeman SD, et al. (1995) Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 85(8): 2005-12.
  • Size / Price
    Catalog:HG12238-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"