Quick Order

Text Size:AAA

Mouse FTH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FTH1cDNA Clone Product Information
cDNA Size:588
cDNA Description:ORF Clone of Mus musculus ferritin heavy chain 1 DNA.
Gene Synonym:FHC, Fth, HFt, MFH, FTH1
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

FTH1 (ferritin, heavy polypeptide 1) is the heavy subunit of ferritin which is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. FTH1 gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. FTH1 stores iron in a soluble, non-toxic, readily available form. It is important for iron homeostasis. It has ferroxidase activity. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. It also plays a role in delivery of iron to cells. FTH1 mediates iron uptake in capsule cells of the developing kidney.

  • Hentze MW, et al. (1986) Cloning, characterization, expression, and chromosomal localization of a human ferritin heavy-chain gene. Proc Natl Acad Sci. 83(19):7226-30.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Stelzl, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-968.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Mouse FTH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Recently Viewed Items