Quick Order

Human GLO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GLO1cDNA Clone Product Information
cDNA Size:555
cDNA Description:ORF Clone of Homo sapiens glyoxalase I DNA.
Gene Synonym:GLYI, GLOD1, GLO1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Mouse Lactoylglutathione lyase, also known as Methylglyoxalase, Aldoketomutase, Glyoxalase I, Ketone-aldehyde mutase, S-D-lactoylglutathione methylglyoxal lyase and GLO1, is a member of the glyoxalase I family. GLO1 / Glyoxalase I is a ubiquitous cellular defense enzyme involved in the detoxification of methylglyoxal, a cytotoxic byproduct of glycolysis. Accumulative evidence suggests an important role of GLO1 expression in protection against methylglyoxal-dependent protein adduction and cellular damage associated with diabetes, cancer, and chronological aging. GLO1 / Glyoxalase I has been implicated in anxiety-like behavior in mice and in multiple psychiatric diseases in humans. GLO1 / Glyoxalase I catalyzes the conversion of hemimercaptal, formed from methylglyoxal and glutathione, to S-lactoylglutathione. GLO1 / Glyoxalase I exists in three separable isoforms which originate from two alleles in the genome. These correspond to two homodimers and one heterodimer composed of two subunits showing different electrophoretic properties. GLO1 upregulation may play a functional role in glycolytic adaptations of cancer cells.

  • Wu, YY. et al., 2008,Prog Neuropsychopharmacol Biol Psychiatry. 32 (7):1740-4.
  • Williams,R. et al., 2009, PLoS One  4 (3): e4649.
  • Antognelli,C. et al., 2009, BMC Cancer  9 :115.
  • Bair,W.B. et al., 2010, Melanoma Res  20 (2):85-96.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items