Quick Order

Text Size:AAA

Human ACHE Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACHEcDNA Clone Product Information
cDNA Size:1845
cDNA Description:ORF Clone of Homo sapiens acetylcholinesterase DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Acetylcholinesterase, also known as ACHE, is an enzyme that degrades (through its hydrolytic activity) the neurotransmitter acetylcholine, producing choline and an acetate group. Acetylcholinesterase plays a crucial role in nerve impulse transmission at cholinergic synapses by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE appears to be a potential therapeutic target at muscle injuries including organophosphate myopathy. It is an externally oriented membrane-bound enzyme and its main physiological role is termination of chemical transmission at cholinergic synapses and secretory organs by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE plays important roles in the cholinergic system, and its dysregulation is involved in a variety of human diseases. ACHE was significantly down-regulated in the cancerous tissues of 69.2% of hepatocellular carcinoma (HCC) patients, and the low ACHE expression in HCC was correlated with tumor aggressiveness, an elevated risk of postoperative recurrence, and a low survival rate. Both the recombinant ACHE protein and the enhanced expression of ACHE significantly inhibited HCC cell growth in vitro and tumorigenicity in vivo. ACHE as a tumor growth suppressor in regulating cell proliferation, the relevant signaling pathways, and the drug sensitivity of HCC cells. Thus, ACHE is a promising independent prognostic predictor for HCC recurrence and the survival of HCC patients. ACHE is responsible for the hydrolysis of acetylcholine in the nervous system. It is inhibited by organophosphate and carbamate pesticides. However, this enzyme is only slightly inhibited by organophosphorothionates.

  • Zhao Y, et al. (2011) Acetylcholinesterase, a key prognostic predictor for hepatocellular carcinoma, suppresses cell growth and induces chemosensitization. Hepatology. 53(2): 493-503.
  • Roepcke CB, et al. (2010) Analysis of phosphorothionate pesticides using a chloroperoxidase pretreatment and acetylcholinesterase biosensor detection. J Agric Food Chem. 58(15): 8748-56.
  • Zaheer-ul-Haq, et al. (2010) Benchmarking docking and scoring protocol for the identification of potential acetylcholinesterase inhibitors. J Mol Graph Model. 28(8): 870-82.
  • Pegan K, et al. (2010) Acetylcholinesterase is involved in apoptosis in the precursors of human muscle regeneration. Chem Biol Interact. 187(1-3): 96-100.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items