Quick Order

Text Size:AAA

Human LSM1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LSM1 cDNA Clone Product Information
Gene_bank_ref_id:BC001767
RefSeq ORF Size:402bp
cDNA Description:Full length Clone DNA of Homo sapiens LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) with C terminal HA tag.
Gene Synonym:CASM, YJL124C, LSM1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

LSM1 is a Sm-like protein. Sm-like proteins can be detected in a variety of organisms based on sequence homology with the Sm protein family. Sm-like proteins include the Sm sequence motif, which consists of two regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM1 has a role in replication-dependent histone mRNA degradation and binds specifically to the 3''-terminal U-tract of U6 snRNA. LSM1 also facilitates RNA protein interactions and structural modifications which are required during ribosomal subunit assembly.

References
  • Shimizu Y, et al. (1997) Lineage- and differentiation stage-specific expression of LSM-1 (LPAP), a possible substrate for CD45, in human hematopoietic cells. Am J Hematol. 54(1):1=11.
  • Graber MW, et al. (1997) CaSm: an Sm-like protein that contributes to the transformed state in cancer cells. Cancer Res. 57(14):2961-5.
  • Séraphin B, et al. (1999) Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18(12):3451-62.
  • Size / Price
    Catalog: HG14142-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"