After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ARF5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ARF5cDNA Clone Product Information
Gene_bank_ref_id:BC003043
cDNA Size:543
cDNA Description:ORF Clone of Homo sapiens ADP-ribosylation factor 5 DNA.
Gene Synonym:ARF5
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

ARF5, also known as ADP-ribosylation factor 5, belongs to the small GTPase superfamily, Arf family. Members of this family stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF5 functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. ARF5 Is involved in protein trafficking. ARF5 may also modulate vesicle budding and uncoating within the Golgi apparatus.

References
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Tsuchiya M. et al., 1991, J Biol Chem. 266 (5): 2772-7.
  • McGuire RE. et al., 1997, Genomics. 41 (3): 481-4.
  • Size / Price
    Catalog:HG14934-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"