Quick Order

Human PDZD11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDZD11cDNA Clone Product Information
Gene_bank_ref_id:BC012996
cDNA Size:423
cDNA Description:ORF Clone of Homo sapiens PDZ domain containing 11 DNA.
Gene Synonym:PISP, AIPP1, PDZK11, PDZD11
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

PDZ domain-containing protein 11, also known as AIPP1a, PISP, PDZD11 and PDZK11, is a cytosolic protein which contains one PDZ (DHR) domain. PDZD11 bears resemblance to members of the MALS / VELIS family of proteins. It contains but one PDZ domain that apparently interacts with the C-terminus of partner proteins. PDZD11 is ubiquitously expressed, and appears to target calcium and copper ATPases to basolateral cell membranes. PDZD11 is a transiently interacting partner of the PMCA b-splice forms that may play a role in their sorting to or from the plasma membrane. Full-length human PDZD11 shares 97% amino acids (aa) identity with mouse PDZD11.

References
  • Goellner,G.M. et al., 2003, Ann N Y Acad Sci. 986 :461-71.
  • Wolf-Yadlin A., et al., 2007, Proc. Natl. Acad. Sci. USA. 104:5860-5.
  • Heibeck T.H., et al.,2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catalog:HG12188-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"