After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse S100A9 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse S100A9 cDNA Clone Product Information
Gene_bank_ref_id:NM_009114.2
RefSeq ORF Size:342bp
cDNA Description:Full length Clone DNA of Mus musculus S100 calcium binding protein A9 (calgranulin B) with N terminal Myc tag.
Gene Synonym:p14, Cagb, GAGB, L1Ag, BEE22, MRP14, 60B8Ag, AW546964, S100a9
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-mS100A9
Restriction Site:KpnI + XbaI (6kb + 0.43kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. Protein S100-A9, also known as S100 calcium-binding protein A9, S100A9, and CAGB, is a member of the S-100 family. S100A9 is expressed by macrophages in acutely inflammed tissues and in chronic inflammation. It is also expressed in epithelial cells constitutively or induced during dermatoses. S100A9 is a calcium-binding protein. It has anti-microbial activity towards bacteria and fungi. The anti-microbial and proapoptotic activity of S100A9 is inhibited by zinc ions. S100A9 plays a role in the development of endotoxic shock in response to bacterial lipopolysaccharide (LPS). It promotes tubulin polymerization when unphosphorylated. It also promotes phagocyte migration and infiltration of granulocytes at sites of wounding. S100A9 plays a role as a pro-inflammatory mediator in acute and chronic inflammation and up-regulates the release of IL8 and cell-surface expression of ICAM1.

References
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Fanò G. et al., 1995, Prog Neurobiol. 46 (1): 71-82.
  • Vogl T. et al., 2004, Blood. 104: 4260-8.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    Catalog: MG50284-NM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"