Quick Order

Human MARK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MARK3cDNA Clone Product Information
Gene_bank_ref_id:BC024773
cDNA Size:2190
cDNA Description:ORF Clone of Homo sapiens MAP/microtubule affinity-regulating kinase 3 DNA.
Gene Synonym:KP78, CTAK1, PAR1A, Par-1a, MARK3
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

MAP / microtubule affinity-regulating kinase 3, also known as C-TAK1, cTAK1, Cdc25C-associated protein kinase 1, ELKL motif kinase 2, Protein kinase STK10, Ser/Thr protein kinase PAR-1, Serine/threonine-protein kinase p78, MARK3, CTAK1 and EMK2, is a ubiquitous expressed protein which belongs to the protein kinase superfamily, CAMK Ser / Thr protein kinase family and MARK subfamily. MARK3 contains one KA1 (kinase-associated) domain, one protein kinase domain and one UBA domain. The Par-1 / MARK protein kinases play a pivotal role in establishing cellular polarity. This family of kinases contains a unique domain architecture, in which a ubiquitin-associated (UBA) domain is located C-terminal to the kinase domain. MARKs / PAR-1 are common regulators of cell polarity that are conserved from nematode to human. All of these kinases have a highly conserved C-terminal domain, which is termed the kinase-associated domain 1 (KA1).

References
  • Kato,T. et al., 2001, Neoplasia.3 (1):4-9.
  • Tochio,N. et al., 2006, Protein Sci. 15 (11):2534-43.
  • Murphy,J.M. et al., 2007, Proc Natl Acad Sci USA.104 (36):14336-41.
  • de Leng,W.W. et al., 2007,Clin Genet. 72 (6):568-73.
  • Chia,C.Y. et al., 2010, IUBMB Life. 62 (3):200-3.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"