After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat PRMT5 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PRMT5 cDNA Clone Product Information
Gene_bank_ref_id:NM_001108867.2
RefSeq ORF Size:1914bp
cDNA Description:Full length Clone DNA of Rattus norvegicus protein arginine methyltransferase 5 with C terminal Myc tag.
Gene Synonym:Skb1
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. Protein arginine methyltransferase 5 (PRMT5) is a member of the protein arginine N-methyltransferases (PRMT)family, and exists as at least homodimers and homotetramers, or homooligomers mediated by disulfide bonds and non-covalent association ubiquitously. PRMT5 specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3), and thus plays a role in the assembly and biogenesis of snRNP core particles. PRMT5 methylates histone H2A and H4 'Arg-3' during germ cell development, as well as histone H3 'Arg-8', which may repress transcription. PRMT5 also methylates SUPT5H and regulates its transcriptional elongation properties. Additionally, it is also suggested that PRMT5 negatively regulates cyclin E1 promoter activity and cellular proliferation.

References
  • Rho. J. et al., 2001, J.Biol. Chem. 276: 11393-11401.
  • Fabbrizio, E.et al., 2002, EMBO.Rep. 3: 641-645.
  • Azzouz, T.N. et al., 2005, J.Biol. Chem. 280: 34435-34440.
  • Pal, S., et al., 2004, Mol. Cell. Biol. 24:9630-9645.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Size / Price
    Catalog: RG81264-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"