After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SLAMF6 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SLAMF6 cDNA Clone Product Information
Gene_bank_ref_id:NM_030710.2
RefSeq ORF Size:996bp
cDNA Description:Full length Clone DNA of Mus musculus SLAM family member 6 with N terminal Myc tag.
Gene Synonym:KAL1, NTBA, KAL1b, Ly108, NTB-A, SF2000, Slamf6
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SLAM family member 6, also known as Activating NK receptor, NK-T-B-antigen, NTB-A, SLAMF6, KALI and Ly108, is a single-pass type I membrane protein which belongs to the CD2 subfamily of the immunoglobulin superfamily. SLAMF6 / Ly108 contains one Ig-like (immunoglobulin-like) domain. It is expressed by all (resting and activated) natural killer cells (NK), T- and B-lymphocytes. SLAMF6 / Ly108 triggers cytolytic activity only in natural killer cells (NK) expressing high surface densities of natural cytotoxicity receptors. SLAMF6 / Ly108 is a homodimer. It interacts with PTN6 and, upon phosphorylation, with PTN11 and SH2D1A/SAP. SLAMF6 / Ly108 undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It may function as a coreceptor in the process of NK cell activation. SLAMF6 / Ly108 can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients.

References
  • Gray CW. et al., 2000, Eur J Biochem. 267 (18): 5699-710.
  • Bottino C. et al., 2001, J Exp Med. 194 (3): 235-46.
  • Valdez PA. et al., 2004, J Biol Chem. 279 (18): 18662-9.
  • Claus M. et al., 2007, Front Biosci. 13: 956-65.
  • Size / Price
    Catalog: MG50275-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"