Quick Order

Text Size:AAA

Mouse PTMA ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PTMA cDNA Clone Product Information
Gene_bank_ref_id:NM_008972.2
RefSeq ORF Size:336bp
cDNA Description:Full length Clone DNA of Mus musculus prothymosin alpha with N terminal Myc tag.
Gene Synonym:Thym, MGC102090, MGC103390, Ptma
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

References
  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • Size / Price
    Catalog: MG50272-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"