After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse S100A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A1cDNA Clone Product Information
Gene_bank_ref_id:NM_011309.3
cDNA Size:285
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A1 DNA.
Gene Synonym:S100, S100a, AI266795, S100a1
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

S100A1 is a Ca2+binding protein of the EF-hand type that belongs to the S100 protein family. S100 proteins consisting of at least 19 members exist as dimers in the cytoplasm and/or nucleus of a wide range of cells, and are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation.This protein has been shown to function in the processes including stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of PKC-mediated phosphorylation.. Phosphoglucomutase is a target protein whose activity is antagonistically regulated by S100A1, and recently, S100A1 is also identified as a potent molecular chaperone and a new member of the Hsp70/Hsp90 multichaperone complex. S100A1 displays a tissue-specific expression pattern with highest levels in myocardium and is considered to be an important regulator of cardiac contractility. Accordingly, reduced expression or mutations of S100A1 gene have been implicated in cardiomyopathies.

References
  • Remppis, A .et al., 1996, Biochim. Biophs. Acta. 1313: 253-257.
  • Most, P. et al., 2001, Proc. Natl. Acad. Sci. U.S.A. 98: 13889-13894
  • Okada, M. et al., 2004, J. Biol. Chem. 279: 4221-4233.
  • Schafer, W.E. et al., 1995, Genomics. 25: 638-643.
  • Landar, A. et al., 1996, Cell. Calcium. 20: 279-285.
  • Size / Price
    Catalog:MG50266-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"