After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse AKT1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse AKT1 cDNA Clone Product Information
Gene_bank_ref_id:NM_009652.2
RefSeq ORF Size:1443bp
cDNA Description:Full length Clone DNA of Mus musculus thymoma viral proto-oncogene 1 with N terminal Myc tag.
Gene Synonym:Akt, PKB, PKB/Akt, PKBalpha, Akt1
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

v-akt murine thymoma viral oncogene homolog 1 (AKT1), or protein kinase B-alpha (PKB-ALPHA) is a serine-threonine protein kinase, belonging to the Protein Kinase Superfamily. AKT1 is a major mediator of the responses to insulin, insulin-like growth factor 1 (IGF1), and glucose. AKT1 also plays a key role in the regulation of both muscle cell hypertrophy and atrophy. AKT1 activity is required for physiologic cardiac growth in response to IGF1 stimulation or exercise training. In contrast, AKT1 activity was found to antagonize pathologic cardiac growth that occurs in response to endothelin 1 stimulation or pressure overload. AKT1 selectively promotes physiological cardiac growth while AKT2 selectively promotes insulin-stimulated cardiac glucose metabolism. AKT1 deletion prevented tumor initiation as well as tumor progression, coincident with decreased Akt signaling in tumor tissues. AKT1 is the primary Akt isoform activated by mutant K-ras in lung tumors, and that AKT3 may oppose AKT1 in lung tumorigenesis and lung tumor progression. A number of separate studies have implicated AKT1 as an inhibitor of breast epithelial cell motility and invasion. AKT1 may have a dual role in tumorigenesis, acting not only pro-oncogenically by suppressing apoptosis but also anti-oncogenically by suppressing invasion and metastasis.

References
  • Hollander MC, et al. (2011) Akt1 deletion prevents lung tumorigenesis by mutant K-ras. Oncogene. 30(15): 1812-21.
  • Devaney JM, et al. (2011) AKT1 polymorphisms are associated with risk for metabolic syndrome. Hum Genet. 129(2): 129-39.
  • Dillon RL, et al. (2010) Distinct biological roles for the akt family in mammary tumor progression. Cancer Res. 70(11): 4260-4.
  • Toker A, et al. (2006) Akt signaling and cancer: surviving but not moving on. Cancer Res. 66(8): 3963-6.
  • Muslin AJ, et al. (2006) Role of Akt in cardiac growth and metabolism. Novartis Found Symp. 274: 118-26.
  • Size / Price
    Catalog: MG50254-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"