Quick Order

Mouse PCSK9 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PCSK9 cDNA Clone Product Information
Gene_bank_ref_id:NM_153565.2
RefSeq ORF Size:2085bp
cDNA Description:Full length Clone DNA of Mus musculus proprotein convertase subtilisin/kexin type 9 with N terminal Myc tag.
Gene Synonym:FH3, Narc1, HCHOLA3, AI415265, AI747682, MGC47409, Pcsk9
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Proprotein convertase subtilisin/kexin type 9 (PCSK9), also known as NARC1 (neural apoptosis regulated convertase), which is a newly identified human secretory subtilase belonging to the proteinase K subfamily of the secretory subtilase family. PCSK9 protein is an enzyme which in humans is encoded by the PCSK9 gene with orthologs found across many species. It is expressed in neuroepithelioma, colon carcinoma, hepatic and pancreatic cell lines, and in Schwann cells. PCSK9 protein is highly expressed in the liver and regulates low density lipoprotein receptor (LDLR) protein levels. Inhibition of PCSK9 protein function is currently being explored as a means of lowering cholesterol levels. Thereby, PCSK9 protein is regarded as a new strategy to treat hypercholesterolemia. PCSK9 protein contributes to cholesterol homeostasis and may have a role in the differentiation of cortical neurons.

References

References
  • Sseidah, N.G. et al., 2003, Proc. Natl. Acad. Sci. USA. 100: 928-933.
  • Beyer, T.P. et al., 2007, J. Lipid. Res. 48: 1488-1498
  • Shan, L. et al., 2008, Biochem. Biophys. Res. Commun. 375: 69-73.
  • Benjannet, S. et al., 2005, J. Biol. Chem. 279: 48865-48875.
  • Abifadel, M. et al., 2003, Nat. Genet. 34: 154-156.
  • Size / Price
    Catalog: MG50251-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"