After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IL17RB ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IL17RB cDNA Clone Product Information
Gene_bank_ref_id:NM_019583.3
RefSeq ORF Size:1500bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 17 receptor B with N terminal Flag tag.
Gene Synonym:Evi27, Il17br, IL-17ER, IL17RH1, IL-17Rh1
Species:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Rhesus IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL-17RD Protein (Fc Tag)Rhesus IL17 / IL17a ProteinRhesus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Canine IL17RD Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Mouse IL25 Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL17RA / CD217 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Human IL-17F / Interleukin-17F Protein (His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman p38 delta / MAPK13 Protein (GST Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human IL17RC Protein (aa 1-454, His Tag)Human IL17RC Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17 / IL17A ProteinRat IL17RA / IL17R Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Rhesus IL17RA / IL17R Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Human IL17 / IL17A Protein (His Tag)Human IL-17F / IL17F ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)
References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catalog: MG51109-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"