Quick Order

Human LSAMP ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human LSAMP cDNA Clone Product Information
NCBI RefSeq:BC033803
RefSeq ORF Size:1017bp
cDNA Description:Full length Clone DNA of Homo sapiens limbic system-associated membrane protein with N terminal HA tag.
Gene Synonym:LAMP, IGLON3, FLJ34254, FLJ35396, FLJ37216, FLJ54658, LSAMP
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

The limbic system-associated membrane protein (LAMP) is a cell surface glycoprotein expressed by cortical and subcortical regions of the mammalian CNS that comprise or receive direct projections from limbic system structures. The 64-68-kDa glycoprotein limbic system-associated membrane protein (LsAMP) is expressed on the surface of somata and proximal dendrites of neurons. These areas perform cognitive and autonomic functions, also learning and memory. The functional analysis indicates that LsAMP acts as a selective adhesion molecule, serving as a guidance cue for specific patterns of connectivity, which underlies the normal development of the limbic system. In animal studies there have been found that rats with increased level of anxiety had 1.6-fold higher expression of LsAMP gene in the periaqueductal gray compared to rats with low level of anxiety, indicating a possible role of LsAMP in the regulation of anxiety.

References
  • Zacco A. et al., 1990, The Journal of Neuroscience. 10(1): 73-90.
  • Pimenta AF. et al., 1996, Gene. 170(2) :189-95.
  • Size / Price
    Catalog: HG12136-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"