After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SRPK3 transcript variant 2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SRPK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001170760.1
RefSeq ORF Size:1701bp
cDNA Description:Full length Clone DNA of Homo sapiens SRSF protein kinase 3 transcript variant 2 with N terminal HA tag.
Gene Synonym:MSSK1, STK23, MSSK-1, MGC102944, SRPK3
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serine / threonine-protein kinase SRPK3, also known as Muscle-specific serine kinase 1, Serine/arginine-rich protein-specific kinase 3, SR-protein-specific kinase 3, Serine / threonine-protein kinase 23, MSSK-1, SRPK3 and MSSK1, is a member of the protein kinase superfamily and CMGC Ser / Thr protein kinase family. SRPK3 is a protein kinase belonging to serine/arginine protein kinases (SRPK) family, which phosphorylates serine / arginine repeat-containing proteins, and is controlled by a muscle-specific enhancer directly regulated by MEF2. SRPK3 / MSSK1 contains one protein kinase domain. SRPK3 / MSSK1 is exclusively expressed in skeletal and heart muscle. It is required for normal muscle development. Myocyte enhancer factor 2 (MEF2) plays essential roles in transcriptional control of muscle development. Normal muscle growth and homeostasis require MEF2-dependent signaling by SRPK3.

References
  • Greenman C., et al., 2007, Nature 446:153-8.
  • Xu,Y. et al., 2011, Mol Biol Rep. 38 (5):2903-9.
  • Size / Price
    Catalog: HG12132-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"