After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CPE Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPEcDNA Clone Product Information
Gene_bank_ref_id:NM_013494.3
cDNA Size:1431
cDNA Description:ORF Clone of Mus musculus Carboxypeptidase E DNA.
Gene Synonym:CPH, fat, Cph1, Cph-1, R74677, MGC7101, Cpe
Species:Mouse
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Human carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

References
  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"