After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse S100A8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A8cDNA Clone Product Information
cDNA Size:270
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A8 (calgranulin A) DNA.
Gene Synonym:p8, B8Ag, CFAg, Caga, MRP8, CP-10, 60B8Ag, AI323541, S100a8
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

S100A8 is a member of the S100 protein family containing 2EF-hand calcium-binding motifs. S100 proteins are involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. Altered expression of S100A8 protein is associated with various diseases and cancers. S100A8 may have an immunoregulatory role by contributing to the regulation of fetal-maternal interactions. It may play a protective role and its absence may allow infiltration by maternal cells, a process eventually manifesting as resorption. The heterodimeric S100 protein complex S100A8/A9 which has been shown to be involved in inflammatory and neoplastic disorders. The complex can induce cell proliferation, or apoptosis, inflammation, collagen synthesis, and cell migration. S100A8/A9 has emerged as important pro-inflammatory mediator in acute and chronic inflammation. More recently, increased S100A8 and S100A9 levels were also detected in various human cancers, presenting abundant expression in neoplastic tumor cells as well as infiltrating immune cells. On the one hand, S100A8/A9 is a powerful apoptotic agent produced by immune cells, making it a very fascinating tool in the battle against cancer. It spears the risk to induce auto-immune response and may serve as a lead compound for cancer-selective therapeutics. In contrast, S100A8/A9 expression in cancer cells has also been associated with tumor development, cancer invasion or metastasis. Altogether, its expression and potential cytokine-like function in inflammation and in cancer suggests that S100A8/A9 may play a key role in inflammation-associated cancer.

  • Passey RJ, et al. (1999) S100A8: emerging functions and regulation. J Leukoc Biol. 66(4): 549-56.
  • Gebhardt C, et al. (2006) S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol. 72(11): 1622-31.
  • Halayko AJ, et al. (2009) S100A8/A9: a mediator of severe asthma pathogenesis and morbidity? Can J Physiol Pharmacol. 87(10): 743-55.
  • Ghavami S, et al. (2009) S100A8/A9: a Janus-faced molecule in cancer therapy and tumorgenesis. Eur J Pharmacol. 625(1-3): 73-83.
  • Ha YS, et al. (2010) mRNA Expression of S100A8 as a Prognostic Marker for Progression of Non-Muscle-Invasive Bladder Cancer. Korean J Urol. 51(1): 15-20.