After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A11cDNA Clone Product Information
Gene_bank_ref_id:NM_016740.3
cDNA Size:297
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A11 (calgizzarin) DNA.
Gene Synonym:cal, EMAPI, Emap1, S100c, S100a14, MGC107585, S100a11
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

References
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Size / Price
    Catalog:MG50227-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"