Quick Order

Text Size:AAA

Mouse MOG ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MOG cDNA Clone Product Information
Gene_bank_ref_id:NM_010814.2
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Mus musculus myelin oligodendrocyte glycoprotein with C terminal Flag tag.
Gene Synonym:B230317G11Rik, Mog
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Myelin oligodendrocyte glycoprotein (MOG) is a transmembrane protein belonging to immunoglobulin superfamily, and contains an Ig-like domain followed by two potential membrane-spanning regions. MOG is expressed only in the CNS with very low content (approximately 0.1% total proteins) in oligodendrogliocyte membrane. Three possible functions for MOG were suggested: (a) a cellular adhesive molecule, (b) a regulator of oligodendrocyte microtubule stability, and (c) a mediator of interactions between myelin and the immune system, in particular, the complement cascade. A direct interaction might exist between the membrane-associated regions of MOG and the myelin-specific glycolipid galactocerebroside (Gal-C), and such an interaction may have important consequences regarding the membrane topology and function of both molecules. It is considered that MOG is an autoantigen capable to produce a demyelinating multiple sclerosis-like disease in experimental animals.

References
  • Chekhonin VP, et al. (2003) Myelin oligodendrogliocyte glycoprotein: the structure, functions, role in pathogenesis of demyelinating disorders. Biomed Khim. 49(5): 411-23.
  • Hilton AA, et al. (1995) Characterization of cDNA and Genomic Clones Encoding Human Myelin Oligodendrocyte Glycoprotein. J Neurochem. 65(1): 309-18.
  • Johns TG, et al. (1999) The Structure and Function of Myelin Oligodendrocyte Glycoprotein. J Neurochem. 72(1): 1-9.
  • Size / Price
    Catalog: MG51046-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"