Quick Order

Mouse BACE2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BACE2cDNA Clone Product Information
cDNA Size:1545
cDNA Description:ORF Clone of Mus musculus beta-site APP-cleaving enzyme 2 DNA.
Gene Synonym:ARP1, BAE2, DRAP, AEPLC, ALP56, ASP21, CDA13, CEAP1, AI850424, 1110059C24Rik, Bace2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

BACE2, also known as beta secretase 2, belongs to the peptidase A1 family. It is a protease known to be an important enzyme involved in the cellular pathways. BACE2 has been shown to interact with GGA1 and GGA2. It is the major β-secretase in vivo. BACE2 is located on chromosome 21 and may play a role in alzheimer's disease pathogenesis in down syndrome(DS). Overexpression of BACE2 by lentivirus markedly reduced amyloid β protein production in primary neurons. Despite an extra copy of the BACE2 gene in DS and the increase of its transcription, BACE2 protein levels are unchanged.

  • Hussain I, et al. (2001) Prodomain processing of Asp1 (BACE2) is autocatalytic. J Biol Chem. 276(26):23322-8.
  • Solans A, et al. (2000) A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet. 89(3-4): 177-84.
  • Hussain I, et al. (2001) ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci. 16(5):609-19.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items