Quick Order

Text Size:AAA

Human PLBD2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLBD2cDNA Clone Product Information
Gene_bank_ref_id:NM_173542.3
cDNA Size:1770
cDNA Description:ORF Clone of Homo sapiens phospholipase B domain containing 2 DNA.
Gene Synonym:P76
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

PLBD2 localizes to the lysosome, as its absence could plausibly lead to a serious yet unrecognized lysosomal storage disease. PLBD1 and PLBD2 are semi-orphans in the sense of being probable phospholipases of B class but with uncertain physiological substrates and thus functionalities. PLBD1 and PLBD2 constitute a small gene family (sequence homology class) within vertebrates though one that occurs expanded in some early diverging eukaryotes. PLBD2 presents a special difficulty in that a sequence of post-translational steps are apparently necessary for its activation. Without these, potential substrates can hardly be assayed. These steps include removal of the signal peptide, mannosylation appropriate to the lysosome targeting receptor, and self-catalytic proteolytic activation to expose the substrate binding site as this becomes appropriate.

References
  • Morgan CP. et al., 2004), Biochem J. 382 (2): 441-9.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012. Cell. 150 (5): 1068-81.
  • Size / Price
    Catalog:HG13947-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"