After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse NETO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NETO1cDNA Clone Product Information
cDNA Size:1602
cDNA Description:ORF Clone of Mus musculus neuropilin (NRP) and tolloid (TLL)-like 1 DNA.
Gene Synonym:Btcl1, AI851453, C130005O10Rik, Neto1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Neuropilin tolloid-like 1 (NETO1), a complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing transmembrane protein, is a novel component of the NMDAR complex critical for maintaining the abundance of NR2A-containing NMDARs in the postsynaptic density. The N-methyl-D-aspartate receptor (NMDAR), a major excitatory ligand-gated ion channel in the central nervous system (CNS), is a principal mediator of synaptic plasticity. Both NETO1 and NETO2 share an identical and unique domain structure thus representing a novel subfamily of CUB- and LDLa-containing proteins. The cytoplasmic domains of NETO1 and NETO2 are not homologous to other known protein sequences but contain a conserved FXNPXY-like motif, which is essential for the internalization of clathrin coated pits during endocytosis or alternatively, may be implicated in intracellular signaling pathways. NETO1 and NETO2, have marked effects on receptor properties, increasing further the potential diversity of Kainate receptors (KARs) functional properties. NETO1 involves in the development and/or maintenance of neuronal circuitry. NETO1 regulates long-term NMDA receptor-dependent synaptic plasticity and cognition, at least in the context of spatial learning and memory.

  • Sthr H, et al. (2002) A novel gene encoding a putative transmembrane protein with two extracellular CUB domains and a low-density lipoprotein class A module: isolation of alternatively spliced isoforms in retina and brain. Gene. 286(2): 223-31.
  • Ng D, et al.d for synaptic plasticity and learning. PLoS Biol. 7(2): e41.
  • Perrais D, et al. (2010) Gating and permeation of kainate receptors: differences unveiled. Trends Pharmacol Sci. 31(11): 516-22.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items