Quick Order

Text Size:AAA

Human GBP2 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human GBP2 cDNA Clone Product Information
NCBI RefSeq:BC073163
RefSeq ORF Size:1776bp
cDNA Description:Full length Clone DNA of Homo sapiens guanylate binding protein 2, interferon-inducible with C terminal HA tag.
Gene Synonym:DKFZp451C2311, GBP2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

GBP-2 belongs to the guanylate-binding protein (GBP) family. GBPs are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP). As GTPases induced by IFN-gamma (Interferon-inducible GTPase), they are key to the protective immunity against microbial and viral pathogens. GBP-2 is a GTPase that converts GTP to GDP and GMP. It binds GTP, GDP and GMP. GBP-2 hydrolyzes GTP very efficiently. GDP rather than GMP is the major reaction product. GBP-2 is induced by interferons that have antiviral effects and inhibit tumor cell proliferation.

References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wistow G, et al. (2002) Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants. Mol Vis. 8:205-20.
  • Neun R, et al. (1996) GTPase properties of the interferon-induced human guanylate-binding protein 2. FEBS Lett. 390(1):69-72.
  • Size / Price
    Catalog: HG13930-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"