Quick Order

Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDK1cDNA Clone Product Information
Gene_bank_ref_id:NM_007659.3
cDNA Size:894
cDNA Description:ORF Clone of Mus musculus cyclin-dependent kinase 1 DNA.
Gene Synonym:Cdc2, Cdc2a, p34, Cdk1
Species:Mouse
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50892-ACG$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50892-ACR$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50892-ANG$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50892-ANR$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50892-CF$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50892-CH$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50892-CM$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50892-CY$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone)MG50892-G$125
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50892-NF$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50892-NH$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50892-NM$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50892-NY$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50892-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

References
  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.
  •  

    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"