Quick Order

Human PRKD2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_016457.4
RefSeq ORF Size:2634bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase D2PRKD2 protein kinase D2 with N terminal HA tag.
Gene Synonym:PKD2, HSPC187
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serine/threonine-protein kinase D2, also known as PRKD2 and PKD2, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD2 / PKD2 is widely expressed. It contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. PRKD2 / PKD2 is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains bind DAG, mediating translocation to membranes. Autophosphorylation of Ser-710 and phosphorylation of Ser-706 by PKC relieves auto-inhibition by the PH domain. PRKD2 / PKD2 converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. Involved in resistance to oxidative stress.

References
  • Zhang QH, et al., 2000, Genome Res 10 (10): 1546-60.
  • Di Bernardo MC, et al.,2008, Nature genetics. 40 (10) :1204-10.
  • Zhang L, et al., 2009, American journal of nephrology. 30 (6) :505-13.
  • Size / Price
    Catalog: HG11671-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"