Quick Order

Human MVK ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MVK cDNA Clone Product Information
NCBI RefSeq:BC016140
RefSeq ORF Size:1191bp
cDNA Description:Full length Clone DNA of Homo sapiens mevalonate kinase with C terminal HA tag.
Gene Synonym:MK, LRBP, MVLK, POROK3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mevalonate kinase belongs to the GHMP kinase family, Mevalonate kinase subfamily. It can be found in a wide variety of organisms from bacteria to mammals. Mevalonate kinase may be a regulatory site in cholesterol biosynthetic pathway. Defects in mevalonate kinase can cause mevalonic aciduria (MEVA). It is an accumulation of mevalonic acid which causes a variety of symptoms such as psychomotor retardation, dysmorphic features, cataracts, hepatosplenomegaly, lymphadenopathy, anemia, hypotonia, myopathy, and ataxia. Defects in mevalonate kinase can also cause hyperimmunoglobulinemia D and periodic fever syndrome (HIDS). HIDS is an autosomal recessive disease characterized by recurrent episodes of unexplained high fever associated with skin rash, diarrhea, adenopathy (swollen, tender lymph nodes), athralgias and/or arthritis.

References
  • Fu Z, et al. (2008) Biochemical and structural basis for feedback inhibition of Mevalonate kinase and isoprenoid metabolism. Biochemistry. 47(12):3715-24.
  • Houten SM, et al. (2000) Biochemical and genetic aspects of Mevalonate kinase and its deficiency. Biochim Biophys Acta. 1529(1-3):19-32.
  • Schafer BL, et al. (1992) Molecular cloning of human Mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem. 267(19): 13229-38.
  • Size / Price
    Catalog: HG13923-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"