After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ACPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACPL2cDNA Clone Product Information
cDNA Size:1443
cDNA Description:ORF Clone of Mus musculus acid phosphatase-like 2 DNA.
Gene Synonym:BB177120, MGC38214, 9430094M07Rik, C130099A20Rik, DKFZp434B2119, Acpl2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to the histidine acid phosphatase family. A large-scale effort, termed the Secreted Protein Discovery Initiative (SPDI), was undertaken to identify novel secreted and transmembrane proteins. In the first of several approaches, a biological signal sequence trap in yeast cells was utilized to identify cDNA clones encoding putative secreted proteins. A second strategy utilized various algorithms that recognize features such as the hydrophobic properties of signal sequences to identify putative proteins encoded by expressed sequence tags (ESTs) from human cDNA libraries. A third approach surveyed ESTs for protein sequence similarity to a set of known receptors and their ligands with the BLAST algorithm. Finally, both signal-sequence prediction algorithms and BLAST were used to identify single exons of potential genes from within human genomic sequence.

  • Clark HF., et al., 2003, Genome Res. 13: 2265-70.
  • Ota al., 2004, Nat. Genet. 36:40-5.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks