Quick Order

Human LOXL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LOXL2cDNA Clone Product Information
Gene_bank_ref_id:NM_002318.2
cDNA Size:2325
cDNA Description:ORF Clone of Homo sapiens lysyl oxidase-like 2 DNA.
Gene Synonym:LOR2, WS9-14, LOXL2
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Lysyl oxidase homolog 2, also known as Lysyl oxidase-like protein 2, Lysyl oxidase-related protein 2, Lysyl oxidase-related protein WS9-14 and LOXL2, is a secreted protein which belongs to the lysyl oxidase family. LOXL2 contains four SRCR domains. The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1-4 ( LOXL1, LOXL2, LOXL3, LOXL4 ). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. LOXL2 expression could also be explored as a molecular target in the prevention of breast cancer progression.

References
  • Peng,L. et al., 2009, Carcinogenesis. 30 (10):1660-9.
  • Hollosi,P. et al., 2009, Int J Cancer. 125 (2):318-27.
  • Rückert,F. et al., 2010, Int J Colorectal Dis. 25 (3):303-11.
  • Iftikhar,M. et al., 2011, J Biol Chem. 286 (2):909-18.
  • Size / Price
    Catalog:HG11664-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"