Quick Order

Mouse CHI3L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHI3L1cDNA Clone Product Information
cDNA Size:1170
cDNA Description:ORF Clone of Mus musculus chitinase 3-like 1 DNA.
Gene Synonym:Gp39, Brp39, AW208766, Chi3l1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Chitinase-3-like protein 1 (CHI3L1) is a secreted heparin-binding glycoprotein whose expression is associated with vascular smooth muscle cell migration. CHI3L1 is expressed at high levels in postconfluent nodular VSMC cultures and at low levels in subconfluent proliferating cultures. CHI3L1 is a tissue-restricted, chitin-binding lectin and member of glycosyl hydrolase family 18. In contrast to many other monocyto / macrophage markers, its expression is absent in monocytes and strong induced during late stages of human macrophage differentiation. Elevated levels of CHI3L1 are associated with disorders exhibiting increased connective tissue turnover, such as rheum atoid, arthritis, osteoarthritis, scleroderma, and cirrhosis of liver, but is produced in cartilage from old donors or patiens with osteoarthritis. CHI3L1 is abnormally expressed in the hippocampus of subjects with schizophrenia and may be involved in the cellular response to various environmental events that are reported to increase the risk of schizophrenia.

  • Zhao XZH, et al. (2007) Functional Variants in the Promoter Region of Chitinase 3-Like 1 (CHI3L1) and Susceptibility to Schizophrenia.The American Journal of Human Genetics. 80 (1): 12-18.
  • Rehli M, et al. (2003) Transcriptional Regulation of CHI3L1, a Marker Gene for Late Stages of Macrophage Differentiation . The Journal of Biological Chemistry. 278: 44058-67.
  • Nishikawa KC, et al. (2003) gp38k (CHI3L1) is a novel adhesion and migration factor for vascular cells. Experimental Cell Research. 287 (1): 79-87
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items