Quick Order

Human SAE1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SAE1 cDNA Clone Product Information
NCBI RefSeq:BC000344
RefSeq ORF Size:1041bp
cDNA Description:Full length Clone DNA of Homo sapiens SUMO1 activating enzyme subunit 1 with C terminal HA tag.
Gene Synonym:AOS1, SUA1, UBLE1A, HSPC140
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SAE1 belongs to the ubiquitin-activating E1 family. It is a heterodimer that acts as a E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It functions as a UBLI E1 ligase mediating the ATP-dependent activation of UBL1. SAE1 binds with UBLE1A and UBLE1B to form a heterodimer which can bind UBL1. SAE1 also regulates ATP-dependent activation of SUMO proteins and formation of a thioester with a conserved cysteine residue on SAE2. SAE1 and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins.

References
  • Gong L, et al. (1999) Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett. 448(1):185-9.
  • Lois LM, et al. (2005) Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to E1. EMBO J. 24(3):439-51.
  • Tatham MH, et al. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem. 276(38):35368-74.
  • Size / Price
    Catalog: HG13921-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"