Quick Order

Text Size:AAA

Human BLOC1S2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BLOC1S2 cDNA Clone Product Information
NCBI RefSeq:BC020494
RefSeq ORF Size:300bp
cDNA Description:Full length Clone DNA of Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 2 with C terminal HA tag.
Gene Synonym:BLOS2, RP11-316M21.4
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

BLOC1S2, also known as BLOS2, belongs to the BLOC1S2 family. It is a component of BLOC-1 complex. The BLOC-1 complex is composed of BLOC1S1, BLOC1S2, BLOC1S3, DTNBP1, MUTED, PLDN, CNO/cappuccino and SNAPIN. The BLOC-1 complex is required for normal biogenesis of lysosome-related organelles, such as platelet dense granules and melanosomes. BLOC1S2 interacts directly with BLOC1S1, BLOC1S3, MUTED, CNO/cappuccino and SNAPIN. It may play a role in cell proliferation. It also plays a role in intracellular vesicle trafficking. Functionally, BLOC1S2 gene has been proposed to participate in processes (melanosome organization, microtubule nucleation, platelet dense granule organization, positive regulation of cell proliferation, positive regulation of transcription, regulation of apoptosis, positive regulation of transcription from RNA polymerase II promoter).

References
  • Sowa ME, et al. (2009) Defining the human deubiquitinating enzyme interaction landscape. Cell. 138(2):389-403.
  • Gdynia G, et al. (2008) BLOC1S2 interacts with the HIPPI protein and sensitizes NCH89 glioblastoma cells to apoptosis. Apoptosis. 13(3):437-47.
  • Starcevic M, et al. (2004) Identification of snapin and three novel proteins (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles complex-1 (BLOC-1). J Biol Chem. 279(27):28393-401.
  • Size / Price
    Catalog: HG13916-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"