Quick Order

Human IDO1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IDO1 cDNA Clone Product Information
NCBI RefSeq:NM_002164.4
RefSeq ORF Size:1212bp
cDNA Description:Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 1 with N terminal HA tag.
Gene Synonym:IDO, INDO, IDO1
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 2007, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.

References
  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.
  • Size / Price
    Catalog: HG11650-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"