Quick Order

Human ADM Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADMcDNA Clone Product Information
cDNA Size:558
cDNA Description:ORF Clone of Homo sapiens adrenomedullin DNA.
Gene Synonym:AM, ADM
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Adrenomedullin consists of 52 amino acids and is a member of the adrenomedullin family. It s a a hypotensive peptide and has 1 intramolecular disulfide bond. It seems that adrenomedullin has a slight homology with the calcitonin gene-related peptide. Adrenomedullin has a highly expression in pheochromocytoma and adrenal medulla. It also can be detected in lung, ventricle and kidney tissues. Adrenomedullin and PAMP are potent hypotensive and vasodilatator agents. Numerous actions have been reported most related to the physiologic control of fluid and electrolyte homeostasis. In the kidney, adrenomedullin is diuretic and natriuretic, and both adrenomedullin and PAMP inhibit aldosterone secretion by direct adrenal actions. In pituitary gland, both peptides at physiologically relevant doses inhibit basal ACTH secretion. Both peptides appear to act in brain and pituitary gland to facilitate the loss of plasma volume, actions which complement their hypotensive effects in blood vessels. It is believed that adrenomedullin functions through combinations of the calcitonin receptor like receptor and receptor activity-modifying proteins complexes, as well as CGRP receptors.

  • Hao SL, et al. (2011) The antifibrosis effect of adrenomedullin in human lung fibroblasts. Exp Lung Res. 37(10):615-26.
  • Hikosaka T, et al. (2011) Adrenomedullin production is increased in colorectal adenocarcinomas; its relation to matrix metalloproteinase-9. Peptides. 32(9):1825-31.
  • Boc-Zalewska A, et al. (2011) Adrenomedullin mRNA expression in placenta of preeclamptic women. Ginekol Pol. 82(8):585-91.
  • Palladini G, et al. (2011) Midregional proadrenomedullin (MR-proADM) is a powerful predictor of early death in AL amyloidosis. Amyloid. 18(4):216-21.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks