After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GPHA2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPHA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_130769.3
RefSeq ORF Size:390bp
cDNA Description:Full length Clone DNA of Homo sapiens glycoprotein hormone alpha 2 with C terminal HA tag.
Gene Synonym:A2, GPA2, ZSIG51, GPHA2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

GPHA2 is a member of the glycoprotein hormones subunit alpha family. Glycoprotein hormones consist of two subunits, the common alpha- and specific beta-subunits, which associate noncovalently to form a heterodimer. The alpha-subunit combines with four distinct beta-subunits giving rise to four biologically active hormones in human: FSH, LH, TSH, and CG. GPHA2 and glycoprotein hormone beta 5 (GPHB5) can form a noncovalent heterodimer. GPHA2 can be detected in a variety of tissues. Recombinant A2/B5 heterodimeric glycoproteins activates human TSH receptors, but not LH and FSH receptors, and shows high affinity to TSH receptors in a radioligand receptor assay. The heterodimer also stimulates cAMP production and thymidine incorporation by cultured thyroid cells and increases serum thyroxine levels in TSH-suppressed rats in vivo. This new heterodimeric glycoprotein hormone was named as thyrostimulin based on its thyroid-stimulating activity. The expression of thyrostimulin in the anterior pituitary known to express TSH receptors suggested a paracrine mechanism.

References
  • Hsu SY. et al., 2002, Science. 295 (5555): 671-4.
  • Suzuki C. et al., 2007, Regul Pept. 142 (1-2): 60-7.
  • Breous E. et al., 2006, Mol Cell Endocrinol. 245 (1-2): 169-80.
  • Size / Price
    Catalog: HG13894-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"