After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FUCA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FUCA1cDNA Clone Product Information
Gene_bank_ref_id:BC017338
cDNA Size:1386
cDNA Description:ORF Clone of Homo sapiens fucosidase, alpha-L- 1, tissue DNA.
Gene Synonym:RP11-45G17.1, FUCA, FUCA1
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

FUCA1 is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in FUCA1 gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. Different phenotypes include clinical features such as neurologic deterioration, growth retardation, visceromegaly, and seizures in a severe early form; coarse facial features, angiokeratoma corporis diffusum, spasticity and delayed psychomotor development in a longer surviving form; and an unusual spondylometaphyseoepiphyseal dysplasia in yet another form.

References
  • Yang M, et al. (1993) A mutation generating a stop codon in the alpha-L-fucosidase gene of a fucosidosis patient. Biochem Biophys Res Commun. 189(2):1063-8.
  • Fukushima H, et al. (1991) Sequencing and expression of a full-length cDNA for human alpha-L-fucosidase. J Inherit Metab Dis. 13(5):761-5.
  • Kretz KA, et al. (1990) Characterization of EcoRI mutation in fucosidosis patients: a stop codon in the open reading frame. J Mol Neurosci. 1(3):177-80.
  • Size / Price
    Catalog:HG13893-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"