After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ALDH1A3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ALDH1A3cDNA Clone Product Information
Gene_bank_ref_id:NM_000693.2
cDNA Size:1539
cDNA Description:ORF Clone of Homo sapiens aldehyde dehydrogenase 1 family, member A3 DNA.
Gene Synonym:ALDH6, RALDH3, ALDH1A6, ALDH1A3
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ALDH1A3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name
Background

Aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), also known as Retinaldehyde dehydrogenase 3 (RALDH3), which belongs to the aldehyde dehydrogenase family. ALDH1A3 is a novel Cancer stem cell (CSC) marker with potential clinical prognostic applicability, and demonstrates a clear correlation between CSC prevalence and the development of metastatic breast cancer. The retinoic acid (RA) biosynthesis enzyme aldehyde dehydrogenase 1A3 (ALDH1A3) is a putative androgen-responsive gene in human prostate cancer epithelial (LNCaP) cells. The RA biosynthesis enzyme ALDH1A3 is androgen responsive and (ii) DHT up-regulation of ALDH1A3 can increase the oxidation of retinal to RA and indirectly affect RA bioactivity and metabolism.

References
  • Marcato P, et al. (2011) Aldehyde dehydrogenase activity of breast cancer stem cells is primarily due to isoform ALDH1A3 and its expression is predictive of metastasis. Stem Cells. 29(1)32-45.
  • Trasino SE, et al. (2007) Androgen regulation of aldehyde dehydrogenase 1A3 (ALDH1A3) in the androgen-responsive human prostate cancer cell line LNCaP. Exp Biol Med (Maywood). 232(6): 762-71.
  • Size / Price
    Catalog:HG11636-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"