Quick Order

Mouse GRK5 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GRK5 cDNA Clone Product Information
NCBI RefSeq:NM_018869.3
RefSeq ORF Size:1773bp
cDNA Description:Full length Clone DNA of Mus musculus G protein-coupled receptor kinase 5 with C terminal Flag tag.
Gene Synonym:Gprk5, Grk5
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

G protein-coupled receptor kinase 5, also known as G protein-coupled receptor kinase GRK5 and GRK5, is a member of the protein kinase superfamily, AGC Ser/Thr protein kinase family and GPRK subfamily. GRKs specifically phosphorylate agonist-occupied G protein-coupled receptors at the inner surface of the plasma membrane (PM), leading to receptor desensitization. GRKs utilize a variety of mechanisms to bind tightly, and sometimes reversibly, to cellular membranes. GRKs play an important role in mediating agonist-specific desensitization of numerous G protein-coupled receptors.
GRK5 contains one AGC-kinase C-terminal domain, one protein kinase domain and one RGS domain. GRK5 specifically phosphorylates the activated forms of G protein-coupled receptors. Phospholipid-stimulated autophosphorylation may represent a novel mechanism for membrane association and regulation of GRK5 activity. GRK5 deficiency significantly exaggerates microgliosis and astrogliosis in the presence of an inflammatory initiator, such as the excess fibrillar Abeta and the subsequent active inflammatory reactions. GRK5 deficiency has been linked to early Alzheimer's disease in humans and mouse models of the disease.

References
  • Kunapuli,P. et al., 1994, J Biol Chem. 269 (14):10209-12.
  • Millman,E.E. et al., 2004, Br J Pharmacol  141 (2):277-84.
  • Thiyagarajan,M.M. et al., 2004, J Biol Chem  279 (17):17989-95.
  • Suo,Z. et al., 2007,Neurobiol Aging. 28 (12):1873-88.
  • Li,L. et al., 2008,J Neuroinflammation. 5 :24.
  • Size / Price
    Catalog: MG50860-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"