Quick Order

Mouse GHR transcript variant 1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GHR cDNA Clone Product Information
Gene_bank_ref_id:NM_010284.2
RefSeq ORF Size:1953bp
cDNA Description:Full length Clone DNA of Mus musculus growth hormone receptor, transcript variant 1 with N terminal Myc tag.
Gene Synonym:GHBP, GHR/BP, AA986417, Ghr
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Growth hormone receptor, also known as GH receptor and GHR, is a single-pass type I  membrane protein which belongs to the type I  cytokine receptor family and type 1 subfamily. GHR contains one fibronectin type-III domain. Growth hormone receptor / GHR is expressed in various tissues with high expression in liver and skeletal muscle. Isoform 4 of GHR is predominantly expressed in kidney, bladder, adrenal gland and brain stem. Isoform 1 expression of GHR in placenta is predominant in chorion and decidua. Isoform 4 is highly expressed in placental villi. Isoform 2 of GHR is expressed in lung, stomach and muscle. Growth hormone receptor / GHR is a receptor for pituitary gland growth hormone. It is involved in regulating postnatal body growth. On ligand binding, it couples to the JAK2 / STAT5 pathway. Isoform 2 of GHR up-regulates the production of GHBP and acts as a negative inhibitor of GH signaling. Defects in GHR are a cause of Laron syndrome (LARS) which is a severe form of growth hormone insensitivity characterized by growth impairment, short stature, dysfunctional growth hormone receptor, and failure to generate insulin-like growth factor I in response to growth hormone. Defects in GHR may also be a cause of idiopathic short stature autosomal (ISSA) which is defined by a subnormal rate of growth.

References
  • Leung DW. et al., 1987, Nature. 330:537-43.
  • Sobrier M-L. et al., 1997, J Clin Endocrinol Metab. 82: 435-7.
  • Enberg B. et al., 2000, Eur J Endocrinol. 143: 71-6.
  • Pantel J. et al., 2000, J Biol Chem. 275: 18664-9.
  • Jorge AAL. et al., 2004, Clin Endocrinol. (Oxf.) 60: 36-40.
  • Size / Price
    Catalog: MG50043-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"