Quick Order

Mouse CCNE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCNE1cDNA Clone Product Information
cDNA Size:1227
cDNA Description:ORF Clone of Mus musculus cyclin E1 DNA.
Gene Synonym:AW538188, Ccne1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Cyclin E1 is a member of the highly conserved cyclin family and belongs to the E-type cyclin that functions as a regulator of S phase entry and progression in mammalian cells. Cyclin E1 serves as regulatory subunits that bind, activate, and provide substrate for its associated cyclin-dependent kinase2 (CDK2), whose activity is essential for cell cycle G1 / S transition. Over expression of this encoding gene has been found in many tumors, which results in chromosome instability and by extension, induce tumorigenesis. This protein was also found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. In general, cyclin E1, as an activator of phospho-CDK2 (pCDK2), is important for cell cycle progression and is frequently overexpressed in cancer cells.

  • Honda R, et al. (2005) The structure of cyclin E1 / CDK2: implications for CDK2 activation and CDK2-independent roles. The EMBO Journal. 24: 452-63.
  • Geng Y, et al. (2007) Kinase-Independent Function of Cyclin E. 25(1): 127-39.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items