After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MSN ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MSN cDNA Clone Product Information
Gene_bank_ref_id:BC017293
RefSeq ORF Size:1734bp
cDNA Description:Full length Clone DNA of Homo sapiens moesin with C terminal HA tag.
Gene Synonym:MSN
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Moesin is a member of the ERM family which includes ezrin and radixin. ERM proteins, highly related members of the larger protein 4.1 superfamily, can exist in an active or inactive conformation. It seems that ERM proteins function as cross-linkers between plasma membranes and actin-based cytoskeletons. The sole Drosophila ERM protein, moesin, functions to promote cortical actin assembly and apical-basal polarity. As a result, cells lacking moesin lose epithelial characteristics and adopt invasive migratory behaviour. It is localized to filopodia and other membranous protrusions that are important for cell-cell recognition and signaling and for cell movement. Moesin contains 1 FERM domain and is expressed in all tissues and cultured cells studied. Moesin has been shown to interact with CD43, Neutrophil cytosolic factor 1, VCAM-1, Neutrophil cytosolic factor 4, ICAM3 and EZR.

References
  • Lankes WT, et al. (1991) Moesin: a member of the protein 4.1-talin-ezrin family of proteins. Proc Natl Acad Sci. 88(19):8297-301.
  • Serrador, J M, et al. (1998) CD43 interacts with moesin and ezrin and regulates its redistribution to the uropods of T lymphocytes at the cell-cell contacts. Blood. 91(12):4632-44.
  • Barreiro Olga, et al. (2002) Dynamic interaction of VCAM-1 and ICAM-1 with moesin and ezrin in a novel endothelial docking structure for adherent leukocytes. J Cell Biol. 157(7):1233-45.
  • Size / Price
    Catalog: HG13866-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"