Quick Order

Mouse CGR2 / CD32 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FCGR2cDNA Clone Product Information
Gene_bank_ref_id:NM_001077189.1
cDNA Size:1023
cDNA Description:ORF Clone of Mus musculus Fc receptor, IgG, low affinity IIb DNA.
Gene Synonym:CD32, Fcgr2, Fcr-2, Fcr-3, Ly-17, LyM-1, Lym-1, FcgRII, Fcgr2a, Ly-m20, AI528646, Fc[g]RII, F630109E10Rik
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Receptors for Fc portion of IgG (Fcγ Rs) are members of the Ig superfamily, and are divided into three classes designated Fcγ RI (CD64), Fcγ RII (CD32), and Fcγ RIII (CD16). CD32 protein is a low affinity receptor for IgG that binds only IgG immune complexes and is expressed on a diverse range of cells such as monocytes, macrophages, neutrophils, eosinophils, platelets, and B cells. Human CD32 class is encoded by three closely related genes, and designated Fcγ RII A, B, and C which share 94-99% amino acid identity in their extracellular domains but differ substantially in their transmembrane and cytoplasmic domains. CD32 is involved in a number of immune responses including antibody-dependent cell-mediated cytotoxicity, clearance of immune complexes, release of inflammatory mediators, and regulation of antibody production.

References
  • Williams TE, et al. (2000) Concurrent and independent binding of Fcgamma receptors IIa and IIIb to surface-bound IgG. Biophys J. 79(4): 1867-75.
  • Kanters D, et al. (2007) Expression of activated Fc gamma RII discriminates between multiple granulocyte-priming phenotypes in peripheral blood of allergic asthmatic subjects. J Allergy Clin Immunol. 120(5): 1073-81.
  • Veri MC, et al. (2007) Monoclonal antibodies capable of discriminating the human inhibitory Fcgamma-receptor IIB (CD32B) from the activating Fcgamma-receptor IIA (CD32A): biochemical, biological and functional characterization. Immunology. 121(3): 392-404.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"