Quick Order

Text Size:AAA

Human VASN ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VASN cDNA Clone Product Information
Gene_bank_ref_id:BC068575
RefSeq ORF Size:2022bp
cDNA Description:Full length Clone DNA of Homo sapiens vasorin with C terminal HA tag.
Gene Synonym:UNQ314/PRO357/PRO1282, SLITL2, VASN
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Vasorin is a typical type I membrane protein. It contains 1 EGF-like domain, 1 fibronectin type-III domain, 10 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. Vasorin is predominantly expressed in vascular smooth muscle cells, and that its expression is developmentally regulated. vasorin It directly binds to transforming growth factor (TGF)-β and attenuates TGF-β signaling in vitro. This suggests that down-regulation of vasorin expression contributes to neointimal formation after vascular injury and that vasorin modulates cellular responses to pathological stimuli in the vessel wall.

References
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Lee KA, et al. (2011) Ubiquitin ligase substrate identification through quantitative proteomics at both the protein and peptide levels. J Biol Chem. 286(48):41530-8.
  • Size / Price
    Catalog: HG13854-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"