Quick Order

Text Size:AAA

Mouse THOP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
THOP1cDNA Clone Product Information
cDNA Size:2064
cDNA Description:ORF Clone of Mus musculus thimet oligopeptidase 1 DNA.
Gene Synonym:EP24.15, AI131655, AI327041, Thop1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

THOP1, also known as Thimet oligopeptidase 1, Thimet oligopeptidase, EC, or EP24.15, is a zinc(II) endopeptidase implicated in the processing of numerous physiological peptides. As an intracellular enzyme, highly expressed in the brain, kidneys and neuroendocrine tissue, THOP1 has been proposed to metabolize peptides within cells, thereby affecting antigen presentation and G protein-coupled receptor signal transduction. Its substrates is gonadotrophin-releasing hormone (GnRH), an important hypothalamic hormone that regulates the synthesis and release of oestradiol and facilitates female sexual behaviour. THOP1 against toxic effects of Abeta in the early stages of Alzheimer disease (AD) pathology, and suggest that the observed increase in THOP1 expression might be part of a compensatory defense mechanism of the brain against an increased Abeta load.

  • Cyr NE, et al. (2010) Nuclear Thimet oligopeptidase is coexpressed with oestrogen receptor alpha in hypothalamic cells and regulated by oestradiol in female mice. J Neuroendocrinol. 22(8): 936-43.
  • Berti DA, et al. (2009) Analysis of intracellular substrates and products of thimet oligopeptidase in human embryonic kidney 293 cells. J Biol Chem. 284(21): 14105-16.
  • Russo LC, et al. (2009) Interaction with calmodulin is important for the secretion of thimet oligopeptidase following stimulation. FEBS J. 276(16): 4358-71.
  • Pollio G, et al. (2008) Increased expression of the oligopeptidase THOP1 is a neuroprotective response to Abeta toxicity. Neurobiol Dis. 31(1): 145-58.
  • Bruce LA, et al. (2008) Hydrogen bond residue positioning in the 599-611 loop of thimet oligopeptidase is required for substrate selection. FEBS J. 275(22): 5607-17.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items