After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human UBASH3A ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human UBASH3A cDNA Clone Product Information
Gene_bank_ref_id:BC069511
RefSeq ORF Size:1872bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitin associated and SH3 domain containing, A with C terminal HA tag.
Gene Synonym:CLIP4, STS-2, TULA, TULA-1, UBASH3A
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

UBASH3A is a member of the T-cell ubiquitin ligand (TULA) family. This family consists of two members. Both of them can negatively regulate T-cell signaling. UBASH3A can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of UBASH3A gene results in multiple transcript variants. It interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. UBASH3A promotes accumulation of activated target receptors, such as T-cell receptors, EGFR and PDGFRB, on the cell surface. UBASH3A also exhibits negligigle protein tyrosine phosphatase activity at neutral pH. It may act as a dominant-negative regulator of UBASH3B-dependent dephosphorylation. It may also inhibit dynamin-dependent endocytic pathways by functionally sequestering dynamin via its SH3 domain.

References
  • Collingwood TS, et al. (2007) T-cell ubiquitin ligand affects cell death through a functional interaction with apoptosis-inducing factor, a key factor of caspase-independent apoptosis.". J. Biol. Chem. 282 (42): 30920-8.
  • Smirnova EV, et al. (2008) TULA proteins bind to ABCE-1, a host factor of HIV-1 assembly, and inhibit HIV-1 biogenesis in a UBA-dependent fashion. Virology. 372(1):10-23.
  • Wattenhofer M, et al. (2001) Isolation and characterization of the UBASH3A gene on 21q22.3 encoding a potential nuclear protein with a novel combination of domains. Hum Genet. 108(2):140-7.
  • Size / Price
    Catalog: HG13847-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"