After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse EPHA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPHA1cDNA Clone Product Information
Gene_bank_ref_id:NM_023580.4
cDNA Size:2934
cDNA Description:ORF Clone of Mus musculus Eph receptor A1 DNA.
Gene Synonym:Eph, Esk, AL033318, 5730453L17Rik, Epha1
Species:Mouse
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ephrin & Eph Receptor Related Products
Product nameProduct name
Cynomolgus EphB1 / EPHT2 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinHuman Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinMouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (Fc Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)
Background

EPHA1 or EPH receptor A1 belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. An important role of Eph receptors and their ligands ephrins is to mediate cell-contact-dependent repulsion. Eph receptors and ephrins also act at boundaries to channel neuronal growth cones along specific pathways, restrict the migration of neural crest cells, and via bidirectional signaling prevent intermingling between hindbrain segments. Eph receptors and ephrins can also trigger an adhesive response of endothelial cells and are required for the remodeling of blood vessels. Eph receptors and ephrins have emerged as key regulators of the repulsion and adhesion of cells that underlie the establishment, maintainence, and remodeling of patterns of cellular organization. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps.

References
  • Flanagan JG, et al. (1998) THE EPHRINS AND EPH RECEPTORS IN NEURAL DEVELOPMENT. Annual Review of Neuroscience. 21: 309-45.
  • Wilkinson DG (2000) Eph receptors and ephrins: Regulators of guidance and assembly. International Review of Cytology. 196: 177-244.
  • Zhou R. (1998) The Eph family receptors and ligands. Pharmacol. 77 (3): 151-81.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"