Quick Order

Human STK40 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
STK40cDNA Clone Product Information
cDNA Size:1308
cDNA Description:ORF Clone of Homo sapiens serine/threonine kinase 40 DNA.
Gene Synonym:SHIK, SgK495, MGC4796, RP11-268J15.4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

STK40 localized to both the cytoplasm and the nucleus. It is ubiquitously expressed. Mechanistically, Stk40 interacts with Rcn2, which also activates Erk1/2 to induce ExEn specification in mouse ESCs. Stk40 is able to activate the Erk/MAPK pathway and induce extraembryonic-endoderm (ExEn) differentiation in mouse ESCs. Interestingly, cells overexpressing Stk40 exclusively contribute to the ExEn layer of chimeric embryos when injected into host blastocysts. In contrast, deletion of Stk40 in ESCs markedly reduces ExEn differentiation in vitro. STK40 has a central serine/threonine protein kinase domain and is homologous to TRB-3, a protein that regulates activation of MAP kinases and inhibits NFκB-mediated gene transcription. Similarly, overexpression of STK40 inhibits NFκB activation triggered by TNF and also inhibits p53-mediated transcription. There are four named isoforms of STK40 that are produced as a result of alternative splicing.

  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10(11): 1788-95.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks